90
|
GenScript corporation
tgfb2 primers f: tgtccctgctgcacttttgta, r: ggtgccatcaatacctgcaaatc Tgfb2 Primers F: Tgtccctgctgcacttttgta, R: Ggtgccatcaatacctgcaaatc, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/mouse+tgfb2+primers+f++ggtgctctgtgggtaccttg++r++ggaagaccctgaactctgcc/pmc11073500-36-1-20 Average 90 stars, based on 1 article reviews
tgfb2 primers f: tgtccctgctgcacttttgta, r: ggtgccatcaatacctgcaaatc - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
lib30 Lib30, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/primers++f+lib30++r+lib30++fam+f+lib30+++biotin+r+lib30++++lib30+cs+biotin/pm28607051-247-2-6 Average 90 stars, based on 1 article reviews
lib30 - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
primers f (cactaagcaataataaatacctctgagg) and r (gtcagtgctgcct tttgtcaacgtc) Primers F (Cactaagcaataataaatacctctgagg) And R (Gtcagtgctgcct Tttgtcaacgtc), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/primers+f++cactaagcaataataaatacctctgagg++and+r++gtcagtgctgcct+tttgtcaacgtc+/pm35977502-242-1-13 Average 90 stars, based on 1 article reviews
primers f (cactaagcaataataaatacctctgagg) and r (gtcagtgctgcct tttgtcaacgtc) - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
GATC Biotech
sanger method with the primers f-relfev and r-relfev Sanger Method With The Primers F Relfev And R Relfev, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/sanger+method+with+the+primers+f+relfev+and+r+relfev/pmc07165395-56-21-7 Average 90 stars, based on 1 article reviews
sanger method with the primers f-relfev and r-relfev - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
Synbio Technologies LLC
oligonucleotide primers f-aga gtt tgatcmtgg ctc ag Oligonucleotide Primers F Aga Gtt Tgatcmtgg Ctc Ag, supplied by Synbio Technologies LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/oligonucleotide+primers+f+aga+gtt+tgatcmtgg+ctc+ag/pm38097737-188-1-17 Average 90 stars, based on 1 article reviews
oligonucleotide primers f-aga gtt tgatcmtgg ctc ag - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
Bio Molecular Systems
16s rrna gene primers (f: gtgstgcayggytgtcgtca; r: acgtcrtccmcaccttcctc) 16s Rrna Gene Primers (F: Gtgstgcayggytgtcgtca; R: Acgtcrtccmcaccttcctc), supplied by Bio Molecular Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/16s+rrna+gene+primers++f++gtgstgcayggytgtcgtca++r++acgtcrtccmcaccttcctc+/pmc07406717-108-12-43 Average 90 stars, based on 1 article reviews
16s rrna gene primers (f: gtgstgcayggytgtcgtca; r: acgtcrtccmcaccttcctc) - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
Synbio Technologies LLC
oligonucleotide primers f-agagtttgatcmtggctcag r-ggttaccttgttacgactt Oligonucleotide Primers F Agagtttgatcmtggctcag R Ggttaccttgttacgactt, supplied by Synbio Technologies LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/oligonucleotide+primers+f+agagtttgatcmtggctcag+r+ggttaccttgttacgactt/pmc10721833-194-6-7 Average 90 stars, based on 1 article reviews
oligonucleotide primers f-agagtttgatcmtggctcag r-ggttaccttgttacgactt - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
SibEnzyme ltd
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) Forward And Reverse M13 Primers (F: 50 Gttttcccagtcacgacgttg 30 And R: 50 Tg Agcggataacaatttcacacag 30), supplied by SibEnzyme ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/forward+and+reverse+m13+primers++f++50+gttttcccagtcacgacgttg+30+and+r++50+tg+agcggataacaatttcacacag+30+/pm21476042-76-15-34 Average 90 stars, based on 1 article reviews
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
oligonucleotide primers f-gr2 and r-gr123 Oligonucleotide Primers F Gr2 And R Gr123, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/oligonucleotide+primers+f+gr2+and+r+gr123/pmc10235511-55-5-14 Average 90 stars, based on 1 article reviews
oligonucleotide primers f-gr2 and r-gr123 - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
Omega Bio Tek
library-seq primers f and r Library Seq Primers F And R, supplied by Omega Bio Tek, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/library+seq+primers+f+and+r/pmc10225669-290-1-30 Average 90 stars, based on 1 article reviews
library-seq primers f and r - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
primers: f-5´-ga aggtcggagtcaacggattt-3´and r-5´-atggg tggaatcatattggaac-3´ Primers: F 5´ Ga Aggtcggagtcaacggattt 3´And R 5´ Atggg Tggaatcatattggaac 3´, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/primers++f+5%C2%B4+ga+aggtcggagtcaacggattt+3%C2%B4and+r+5%C2%B4+atggg+tggaatcatattggaac+3%C2%B4/pm26459268-73-17-21 Average 90 stars, based on 1 article reviews
primers: f-5´-ga aggtcggagtcaacggattt-3´and r-5´-atggg tggaatcatattggaac-3´ - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
pair of primers f: 50-gaatttgtggcttgcaggaa-30 and r: 50-agaatcccacagacagaagagc-30 Pair Of Primers F: 50 Gaatttgtggcttgcaggaa 30 And R: 50 Agaatcccacagacagaagagc 30, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primers+f/pair+of+primers+f++50+gaatttgtggcttgcaggaa+30+and+r++50+agaatcccacagacagaagagc+30/pm18446445-37-22-0 Average 90 stars, based on 1 article reviews
pair of primers f: 50-gaatttgtggcttgcaggaa-30 and r: 50-agaatcccacagacagaagagc-30 - by Bioz Stars,
2026-11
90/100 stars
|
Buy from Supplier |